|
|
extractfeat |
Please help by correcting and extending the Wiki pages.
extractfeat is a simple utility for extracting regions of a sequence that are annotated as being a specified type of feature. It reads one or more sequences, and writes out the sequences and features of interest to an output sequence file. 'joined' features can either be extracted as individual sequences, or as a single concatenated sequence if the -join qualifier is used. If the feature is annotated as being in the reverse sense of a nucleic acid sequence, then that feature's sub-sequence is reverse-complemented before it is written.
There are many options control exactly what parts of the feature table are given in the output file. In addition, it is often useful to have contextual information about a feature. There are options to specify a number of positions before and/or after the specified feature which will be reported in the output file.
To write out the exons of a sequence:
% extractfeat tembl:x65921 -type exon Extract features from sequence(s) output sequence [x65921.fasta]: |
Go to the input files for this example
Go to the output files for this example
Example 2
To write out the exons with 10 extra bases at the start and end so that you can inspect the splice sites:
% extractfeat tembl:x65921 -type exon -before 10 -after 10 Extract features from sequence(s) output sequence [x65921.fasta]: |
Go to the output files for this example
Example 3
To write out the 10 bases around the start of all 'exon' features in the tembl database:
% extractfeat 'tembl:*' -type exon -before 5 -after -5 Extract features from sequence(s) output sequence [h45989.fasta]: |
Go to the output files for this example
Example 4
To extract the CDS region with the exons joined into one sequence:
% extractfeat tembl:x65921 -type CDS -join Extract features from sequence(s) output sequence [x65921.fasta]: |
Go to the output files for this example
Example 5
To write out the 7 residues around all phosphorylated serine residues
% extractfeat 'tsw:*' -type MOD_RES -value 'phosphoserine*' -before 3 -after -4 Extract features from sequence(s) output sequence [12s1_arath.fasta]: |
Go to the output files for this example
Extract features from sequence(s)
Version: EMBOSS:6.2.0
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence(s) filename and optional format, or
reference (input USA)
[-outseq] seqout [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | Sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
| Additional (Optional) qualifiers | ||||
| -before | integer | If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature. So a value of '10' will start the extraction 10 bases/residues before the start of the sequence, and a value of '-10' will start the extraction 10 bases/residues before the end of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence starts after the required start of the extraction. | Any integer value | 0 |
| -after | integer | If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature. So a value of '10' will end the extraction 10 bases/residues after the end of the sequence, and a value of '-10' will end the extraction 10 bases/residues after the start of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence ends before the required end of the extraction. | Any integer value | 0 |
| -source | string | By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl | Any string | * |
| -type | string | By default every feature in the feature table is extracted. You can set this to be any feature type you wish to extract. See http://www.ebi.ac.uk/embl/WebFeat/ for a list of the EMBL feature types and see the Uniprot user manual in http://www.uniprot.org/manual/sequence_annotation for a list of the Uniprot feature types. The type may be wildcarded by using '*'. If you wish to extract more than one type, separate their names with the character '|', eg: *UTR | intron | Any string | * |
| -sense | integer | By default any feature type in the feature table is extracted. You can set this to match any feature sense you wish. 0 - any sense, 1 - forward sense, -1 - reverse sense | Any integer value | 0 - any sense, 1 - forward sense, -1 - reverse sense |
| -minscore | float | Minimum score of feature to extract (see also maxscore) | Any numeric value | 0.0 |
| -maxscore | float | Maximum score of feature to extract. If both minscore and maxscore are zero (the default), then any score is ignored | Any numeric value | 0.0 |
| -tag | string | Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is extracted. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label | Any string | * |
| -value | string | Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag value you wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with a space or the character '|', eg: pax* | 10 | Any string | * |
| -join | boolean | Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. If this option is set TRUE, then any group of these features will be output as a single sequence. If the 'before' and 'after' qualifiers have been set, then only the sequence before the first feature and after the last feature are added. | Boolean value Yes/No | No |
| -featinname | boolean | To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the sequence ID name. If you set this to be TRUE then the name is added to the ID name of the output sequence. | Boolean value Yes/No | No |
| -describe | string | To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any). For example, if this is set to be 'gene', then if any output feature has the tag (for example) '/gene=BRCA1' associated with it, then the text '(gene=BRCA1)' will be added to the Description line. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default no feature tag is displayed. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label | Any string | |
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outseq" associated seqout qualifiers | ||||
| -osformat2 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension2 -osextension_outseq |
string | File name extension | Any string | |
| -osname2 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo2 -oufo_outseq |
string | UFO features | Any string | |
| -offormat2 -offormat_outseq |
string | Features format | Any string | |
| -ofname2 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
Feature tables in Swissprot, EMBL, GFF, etc. format can be added using '-ufo featurefile' on the command line.
ID X65921; SV 1; linear; genomic DNA; STD; HUM; 2016 BP.
XX
AC X65921; S45242;
XX
DT 13-MAY-1992 (Rel. 31, Created)
DT 14-NOV-2006 (Rel. 89, Last updated, Version 7)
XX
DE H.sapiens fau 1 gene
XX
KW fau 1 gene.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC Homo.
XX
RN [1]
RP 1-2016
RA Kas K.;
RT ;
RL Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN [2]
RP 1-2016
RX DOI; 10.1016/0006-291X(92)91286-Y.
RX PUBMED; 1326960.
RA Kas K., Michiels L., Merregaert J.;
RT "Genomic structure and expression of the human fau gene: encoding the
RT ribosomal protein S30 fused to a ubiquitin-like protein";
RL Biochem. Biophys. Res. Commun. 187(2):927-933(1992).
XX
DR GDB; 191789.
DR GDB; 191790.
DR GDB; 354872.
DR GDB; 4590236.
XX
FH Key Location/Qualifiers
FH
FT source 1..2016
FT /organism="Homo sapiens"
FT /mol_type="genomic DNA"
FT /clone_lib="CML cosmid"
FT /clone="15.1"
FT /db_xref="taxon:9606"
FT mRNA join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT /gene="fau 1"
FT exon 408..504
FT /number=1
[Part of this file has been deleted for brevity]
FT RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT intron 857..950
FT /number=2
FT exon 951..1095
FT /number=3
FT intron 1096..1556
FT /number=3
FT exon 1557..1612
FT /number=4
FT intron 1613..1786
FT /number=4
FT exon 1787..>1912
FT /number=5
FT polyA_signal 1938..1943
XX
SQ Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac 60
ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac 120
tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt 180
agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta 240
gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg 300
tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag 360
gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca 420
cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc 480
gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg 540
tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg 600
tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc 660
cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct 720
ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa 780
tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac 840
ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct 900
tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag 960
cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg 1020
aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag 1080
gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag 1140
tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc 1200
tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg 1260
tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct 1320
ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt 1380
agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg 1440
ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt 1500
ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa 1560
agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga 1620
gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg 1680
ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag 1740
gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga 1800
gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt 1860
caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg 1920
taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt 1980
tacttgcaag gcctcaggga gaggtgtgct tctcgg 2016
//
|
>X65921_408_504 [exon] H.sapiens fau 1 gene cagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttcttcctctttct cgactccatcttcgcggtagctgggaccgccgttcag >X65921_774_856 [exon] H.sapiens fau 1 gene tcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggcc aggaaacggtcgcccagatcaag >X65921_951_1095 [exon] H.sapiens fau 1 gene gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggc gcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctg gaagtagcaggccgcatgcttggag >X65921_1557_1612 [exon] H.sapiens fau 1 gene gtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaag >X65921_1787_1912 [exon] H.sapiens fau 1 gene gtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtac aaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaac tcttaa |
>X65921_408_504 [exon] H.sapiens fau 1 gene ggtcgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttct tcctctttctcgactccatcttcgcggtagctgggaccgccgttcaggtaagaatgg >X65921_774_856 [exon] H.sapiens fau 1 gene ctttactcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgag gtgaccggccaggaaacggtcgcccagatcaaggtaaggctgc >X65921_951_1095 [exon] H.sapiens fau 1 gene ttccctgtaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccct gactaccctggaagtagcaggccgcatgcttggaggtgagtgaga >X65921_1557_1612 [exon] H.sapiens fau 1 gene cccactacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagact cctaaggtgagtgaga >X65921_1787_1912 [exon] H.sapiens fau 1 gene ccttctccaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcg gatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccc caatgccaactcttaagtcttttgta |
>X65921_408_504 [exon] H.sapiens fau 1 gene ctcagcagtg >X65921_774_856 [exon] H.sapiens fau 1 gene ctcagtcgcc >X65921_951_1095 [exon] H.sapiens fau 1 gene tgtaggctca >X65921_1557_1612 [exon] H.sapiens fau 1 gene tacaggtaaa >X65921_1787_1912 [exon] H.sapiens fau 1 gene tccaggtggc >K00650_889_1029 [exon] Human fos proto-oncogene (c-fos), complete cds. ccacgatgat >K00650_1783_2034 [exon] Human fos proto-oncogene (c-fos), complete cds. tctaggactt >K00650_2466_2573 [exon] Human fos proto-oncogene (c-fos), complete cds. tctagttatc >K00650_2688_3329 [exon] Human fos proto-oncogene (c-fos), complete cds. tacaggagac >D00596_1001_1205 [exon] Homo sapiens gene for thymidylate synthase, complete cds. gcgccatgcc >D00596_2895_2968 [exon] Homo sapiens gene for thymidylate synthase, complete cds. ttcagatgaa >D00596_5396_5570 [exon] Homo sapiens gene for thymidylate synthase, complete cds. tccagggatc >D00596_11843_11944 [exon] Homo sapiens gene for thymidylate synthase, complete cds. tacagattat >D00596_13449_13624 [exon] Homo sapiens gene for thymidylate synthase, complete cds. ctcagatctt >D00596_14133_14204 [exon] Homo sapiens gene for thymidylate synthase, complete cds. tatagccagg >D00596_15613_15750 [exon] Homo sapiens gene for thymidylate synthase, complete cds. tttagcttca >AB009071_67_155 [exon] Homo sapiens HERG gene, complete cds. cccgcccatg >AB009071_356_586 [exon] Homo sapiens HERG gene, complete cds. cctaggccgt >AB009071_768_932 [exon] Homo sapiens HERG gene, complete cds. tgcagggagc >AB009071_1137_1580 [exon] Homo sapiens HERG gene, complete cds. cgcaggccgc >AB009071_1742_1953 [exon] Homo sapiens HERG gene, complete cds. cctaggggcc >AB009071_2168_2596 [exon] Homo sapiens HERG gene, complete cds. tgcaggtcct >AB009071_2765_3152 [exon] Homo sapiens HERG gene, complete cds. cccagctgat >AB009071_3332_3531 [exon] Homo sapiens HERG gene, complete cds. cccagccctc >AB009071_3716_3968 [exon] Homo sapiens HERG gene, complete cds. cccaggtgct [Part of this file has been deleted for brevity] aacagctcct >U01317_39414_39558 [exon] Human beta globin region on chromosome 11. tccacacact >U01317_39681_39903 [exon] Human beta globin region on chromosome 11. cacaggctcc >U01317_40770_40985 [exon] Human beta globin region on chromosome 11. aacagctcct >U01317_45710_45800 [exon] Human beta globin region on chromosome 11. acactgtagt >U01317_45922_46145 [exon] Human beta globin region on chromosome 11. cacagtctcc >U01317_46997_47124 [exon] Human beta globin region on chromosome 11. cccagctctt >U01317_54740_54881 [exon] Human beta globin region on chromosome 11. tgcttacact >U01317_55010_55232 [exon] Human beta globin region on chromosome 11. ctcagattac >U01317_56131_56389 [exon] Human beta globin region on chromosome 11. cgcagctctt >U01317_62137_62278 [exon] Human beta globin region on chromosome 11. tgcttacatt >U01317_62187_62278 [exon] Human beta globin region on chromosome 11. acaccatggt >U01317_62390_62408 [exon] Human beta globin region on chromosome 11. attggtctat >U01317_62409_62631 [exon] Human beta globin region on chromosome 11. cttaggctgc >U01317_63482_63742 [exon] Human beta globin region on chromosome 11. cacagctcct >M23100_1541_1923 [exon] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13). ctccgggccc >M23100_1542_1923 [exon] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13). tccgggcccc >M23100_1548_1923 [exon] Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13). ccccgagatc >V00451_363_460 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). gaaatatggg >V00451_555_663 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). aataggatat >V00451_2182_2286 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). tgtaggtgcg >V00451_3065_3208 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). cgtaggtggt >M11903_351_499 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced. cctgtaggca >M11903_401_499 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced. gctctcagtc >M11904_109_445 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 2 and complete cds. aacagaaaaa >M11905_233_420 [exon] Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 3. cacaggttgt |
>X65921_782_1912 [CDS] H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
>AQP1_HUMAN_247_247 [protein_modification_categorized_by_chemical_process] Aquaporin-1 (AQP-1) (Aquaporin-CHIP) (Water channel protein for red blood cells and kidney proximal tubule) (Urine water channel) VWTSGQV >AQP1_HUMAN_262_262 [protein_modification_categorized_by_chemical_process] Aquaporin-1 (AQP-1) (Aquaporin-CHIP) (Water channel protein for red blood cells and kidney proximal tubule) (Urine water channel) DINSRVE >GCN4_YEAST_17_17 [protein_modification_categorized_by_chemical_process] General control protein GCN4 (Amino acid biosynthesis regulatory protein) MGFSPLD >GCN4_YEAST_218_218 [protein_modification_categorized_by_chemical_process] General control protein GCN4 (Amino acid biosynthesis regulatory protein) IPLSPIV >OPSD_HUMAN_334_334 [protein_modification_categorized_by_chemical_process] Rhodopsin (Opsin-2) DEASATV >OPSD_HUMAN_338_338 [protein_modification_categorized_by_chemical_process] Rhodopsin (Opsin-2) ATVSKTE >OPSD_HUMAN_343_343 [protein_modification_categorized_by_chemical_process] Rhodopsin (Opsin-2) TETSQVA >PAXI_HUMAN_83_83 [protein_modification_categorized_by_chemical_process] Paxillin QPQSSSP >PAXI_HUMAN_85_85 [protein_modification_categorized_by_chemical_process] Paxillin QSSSPVY >PAXI_HUMAN_106_106 [protein_modification_categorized_by_chemical_process] Paxillin SVGSPCS >PAXI_HUMAN_109_109 [protein_modification_categorized_by_chemical_process] Paxillin SPCSRVG >PAXI_HUMAN_126_126 [protein_modification_categorized_by_chemical_process] Paxillin KQKSAEP >PAXI_HUMAN_130_130 [protein_modification_categorized_by_chemical_process] Paxillin AEPSPTV >PAXI_HUMAN_137_137 [protein_modification_categorized_by_chemical_process] Paxillin MSTSLGS >PAXI_HUMAN_303_303 [protein_modification_categorized_by_chemical_process] Paxillin GRSSPGG >UBR5_RAT_193_193 [protein_modification_categorized_by_chemical_process] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog) (100 kDa protein) (Fragment) GRPSQGL >UBR5_RAT_607_607 [protein_modification_categorized_by_chemical_process] E3 ubiquitin-protein ligase UBR5 (6.3.2.-) (E3 ubiquitin-protein ligase, HECT domain-containing 1) (Hyperplastic discs protein homolog) (100 kDa protein) (Fragment) SSRSVVD |
The sequences of the specified features are written out.
The ID name of the sequence is formed from the original sequence name with the start and end positions of the feature appended to it. So if the feature came from a sequence with an ID name of 'XYZ' from positions 10 to 22, then the resulting ID name of the feature sequence will be 'XYZ_10_22'
The name of the type of feature is added to the start of the description of the sequence in brackets, e.g.: '[exon]'.
The sequence is written out as a normal sequence.
If the feature is in the reverse sense of a nucleic acid sequence, then it is reverse-complemented before being written.
Bear in mind that database annotation cannot always be trusted to be reliable. If you rely upon annotation written by other people or another program and do not independently verify such annotation, then there is a chance that some of the reported features will be erreneous.
There are many options to control exactly what parts of the feature table are written to file.
By default every feature in the feature table is extracted. -type will set the specific feature type to extract. See http://www.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.uniprot.org/manual/sequence_annotation for a list of the Swissprot feature types.
By default any feature tag in the feature table is extracted. -tag specifies a feature tag reuired in any feature extracted. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags /codon, /codon_start, /db_xref, /EC_number, /evidence, /exception, /function, /gene, /label, /map, /note, /number, /partial, /product, /protein_id,/pseudo, /standard_name, /translation, /transl_except, /transl_table, or /usedin. Some of these tags also have values, for example /gene can have the value of the gene name.
By default any feature tag value in the feature table is shown. You can set this using -tag to match any specific feature tag value you wish to show. Tag values are the values associated with a feature tag, for example /gene can have the value of the gene name. Bear in mind only some of these tags can have values.
By default any feature source in the feature table is shown. -source is used to set this to match a specific feature source.
By default features in either sense are extracted. The -sense option specifies a particular sense.
The minimum and maximum score of features to be reported may be specified with -minscore and -maxscore.
To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the output sequence ID name. The -featinname option specifies this behaviour.
To aid you in identifying the properties of a feature that has been output, -describe specifies one or more tag names that will be added to the output sequence "Description" text, together with their values (if any). For example, if this is set to be gene, then if any output feature has the tag (for example) /gene=BRCA1 associated with it, then the text (gene=BRCA1) will be added to the Description line. By default no feature tag is given in the "Description" text. You can set -describe to specify any feature tag you wish to show.
Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. By default, 'joined' features are extracted as individual sequences. If the -join option is specified, then any group of these features will be output as a single sequence. If the -before and -after qualifiers have been set, then only the sequence before the first feature and after the last feature are added.
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| coderet | Extract CDS, mRNA and translations from feature tables |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| showfeat | Display features of a sequence in pretty format |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| twofeat | Finds neighbouring pairs of features in sequence(s) |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
Added '-join' parameter (June 2002) - Gary Williams